日本語

1. Search:Search for papers and data
---- Papers using genetic markers and mtDNA data (sequences and their frequency in populations) for Japanese freshwater fishes can be searched ---
  • Users can search data ("Populations", "Haplotypes", and "References") using various keys, including [Keywords], [Taxonomy], [Geographical regions], and [Sequences] (homology search), at [Database] in the left menu.
  • In each search, users can select the search object, i.e., "Populations", "Haplotypes", and "References" the results are stored in [Database] > [Search Result] separately for each object.

Search:

  • [Keywords Search]: Users can search data using free keywords (scientific/Japanese names, locality names, etc.), database fields, or mtDNA regions. The search object (=Populations, Haplotypes, and References) can be selected from the drop-down list on the right of the keyword field.
  • [Taxonomic Search]: Users can search data using taxonomic names (order, family, genus, species, subspecies). Lower taxonomic groups are shown by click on the &+& mark on the head of each taxonomic name. The numbers of registered data for each search object are shown; users can pick up the data by click on the numbers.
  • [Geographical Search]: Users can search data of populations by selecting an area on map [Map], areas [Local Division], names of river systems [Rivers], lakes and ponds [Lakes/Ponds], and administrative prefectures [Prefectures]. [Map] search can be performed for each family.
  • [Homology Search]: Users can conduct "BLAST search" to either GEDIMAP or DDBJ data using mtDNA nucleotide sequences in hand (see #2).
  • [New Data]: The data recently registered can be listed up.

Search results:

  • Results of search are stored in [Populations], [Haplotypes], and [Reference] boxes in [Database] > [Search Result] in the left menu, separately.
  • GEDIMAP accession numbers are given for populations (P#), haplotypes (H#), and references (R#), for convenience to search and refer to the data in scientific papers.
  • Population, haplotype, and reference data are linked to each other, as well as to external databases, including DOI, PubMed, fishbase, DDBJ, and BOLD.
  • Reference database includes scientific articles on phylogeny, taxonomy, species-identification, and population structure of Japanese freshwater fishes using molecular makers, including mtDNA sequence (mtseq), mtDNA RFLP (mtRFLP), protein polymorphism (allozyme; prot), nuclear DNA sequence (ncseq), microsatellite (microsat), AFLP, RAPD, minisatellite (minisat), and others. Any information on literature from users is greatly welcomed (mail to ).
  • Users can accumulatively store the searched data in [Database] > [Marked Data & Analysis] for manipulation and analysis, by checking the [Mark] box of each data (see #4).
**********************************************
2. Identification:Identify a mtDNA sequence in hand into species or populations
--- Homology search to GEDIMAP and DDBJ data can be performed for mtDNA sequences in hand ---
  • Homology search to either GEDIMAP or international DNA databases can be done for users' sequences using Blastn program (Altschul et al. 1997: Nucleic Acids Res. 25:3389-3402)
  • In searching to GEDIMAP, users can select a search object (Populations, Haplotypes, or References).
  • Details of Blastn search are shown by click on the icon at the each data.
  • Score (bits) and identity (%) values are easy indices for relative closeness between the query sequence and output sequences in database. Notice that accuracy of identification should be low when no (or few) close data are registered in the database (usually data roughly <90% identity value should be ignored.)
  • In searching to the international DNA database, the data are sent to BLAST WWW System DDBJ (DNA Data Bank of Japan)
**********************************************
3. Tool:Help for manipulation of unregistered data and making files for analysis/registration
--- GEDIMAP can be used as a platform for manipulation and data-file preparation of user's unregistered data ---

Sorry, this service is under construction.

**********************************************
4. Analysis:Analyze data / Make a data file from database
--- The searched data can be further selected, and be used for analysis and output of data files ---
  • - Users can accumulatively store the searched data in [Database] > [Marked Data & Analysis] for manipulation and analysis, by checking the [Mark] box of each data.

Populations:

  • [Grouping]: Multiple populations can be grouped.
  • For populations or population groups, several analyses and output can be done from the top menu: [Arlequin], [FASTA], [Diversity indices], [UPGMA], and [NJTree].
  • [Arlequin]: Data file (.arp) for the comprehensive software package for population genetics ARLEQUIN (Excoffier et al., 2005) is produced from marked population data.
  • [FASTA]: A "Fasta" file (.fas) containing the haplotypes included in selected populations is output. It is available for many programs such as an alignment program ClustalW.
  • [Diversity indices]: Nei's D (nucleotide diversity between populations, as proportion to sequence length) and DA (net nucleotide diversity) are calculated.
  • [UPGMA]: UPGMA tree based on the population distances of DA is shown.
  • [NJTree]: Neighbor-joining tree based on the population distances of DA is shown.
  • Neighbor program of PHYLIP 3.6 is used for calculation of UPGMA and NJ trees.
  • Note that only aligned, same-length sequences can be directly analyzed in GEDIMAP. For non-aligned sequences, output files (.arp, .fas) should be analyzed by other software packages.
  • Results of the analyses in GEDIMAP are NOT guaranteed: we highly recommend that users use other confident software for scientific papers.

Haplotypes:

  • [FASTA]: A Fasta file (.fas) containing the selected haplotypes is output.
  • [ClustalW]: Alignment of haplotypes can be performed by ClustalW in EMBL-EBI site. NJ tree of the aligned haplotypes is also shown.

References:

  • Selected references are listed.
**********************************************
5. Registration:Register user's data
--- Users are welcomed to register published or unpublished data in hand to GEDIMAP, and contribute to enrich the database ---

A. User registration

  • Before registration of mtDNA data (sequences and frequency) and references, users are required to be registered and get ID
  • Send an e-mail to the GEDIMAP administrator first [] to get ID and password for registration of data, please.

B. Data registration

--- Users can register data to GEDIMAP from the Internet browser after login ---

  • To enter [Data registration] in the left menu, users are required to input ID and Password for login.
  • GEDIMAP primarily targets data of Japanese freshwater fish species/subspecies. Their populations and relatives distributed in East Asian regions can be also included.
  • MtDNA sequences, frequency of haplotypes, and related data (geography, reference, comments) can be registered to GEDIMAP.
  • When users find unregistered species, let the administrator know it by e-mail , please.

--- The data are registered separately: first, haplotypes (1), and second, population information (2). Both data are necessary but can be registered at different times ---

(1) Registration of haplotypes

  • Users can register haplotype sequences with information on the family (e.g., Cyprinidae) and region(s) of mtDNA (e.g., cyt b). Haplotypes should be aligned before registration.
  • A set of haplotypes from a single reference can be registered together.
    (Style)
    [Name of haplotype] + blank+ [sequence]
    (Example)
    hap01 ACGTACGTAAGTGATAGATCCA
    hap02 ACGTACGTAAGTGATA-GATCC
    hap03 NNNACGTAAGTGAT---GATCC
        (*Note that haplotypes must be of same length and aligned.)
  • Input reference information (from the drop-down list) and accession numbers of international DNA databank following wizard.

(2) Registration of populations

  • Users can register information of each population, including a species name, haplotype frequency, geographic information, reference, and other data, one by one following wizard.

Others

  • Users are strongly recommended to register the sequence data to the international DNA data bank (DDBJ/GenBank/EMBL) and get accession numbers before registration to GEDIMAP.
  • Unpublished data can be masked against users other than the person who registered the data.
  • Most of the data items can be edited after log-in. To revise the uneditble data, please send e-mail to the administrator
____________